View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13856_low_25 (Length: 237)
Name: NF13856_low_25
Description: NF13856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13856_low_25 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 49159939 - 49160160
Alignment:
| Q |
1 |
tcgtggtagccaagcacaagccttcttagattccctatatttgagtcatgtatgcagtagtttgacctagattcttgatgatccactaacccaaacatca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49159939 |
tcgtggtagccaagcacaagccttcttagactccccatatttgagtcatgtatgcagtagtttgacctagattcttgatgatccactaacccaaacatca |
49160038 |
T |
|
| Q |
101 |
ttgtcgtccctaatcatccctccacaacgagagcaaaacactgtcattccctttcgaagtttcatacgtgtttaagacaatgttactaatcactttttca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
49160039 |
ttgtcgtccctaatcatccctccacaacgagagcaaaacactgtcattcccttttgaagtttcatacgtgtttaagacaatattactaatcactttttca |
49160138 |
T |
|
| Q |
201 |
tgctcgaccatatcatgatcat |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
49160139 |
tgctcgaccatatcatgatcat |
49160160 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University