View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13856_low_27 (Length: 228)
Name: NF13856_low_27
Description: NF13856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13856_low_27 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 117; Significance: 9e-60; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 117; E-Value: 9e-60
Query Start/End: Original strand, 1 - 159
Target Start/End: Complemental strand, 50253125 - 50252974
Alignment:
| Q |
1 |
ggtccgaaatcacgccgatatgccaaaagaaaacagaaaaacaccatactgctataacatctaaacacaccaagttgcagctggccctaaaacagcacca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50253125 |
ggtccgaaatcacgccgatatgccaaaagaaaa-------acaccatactgctataacaactaaacacaccaagttgcagctggccctaaaacagcacca |
50253033 |
T |
|
| Q |
101 |
aaggctcaaaactcggactgcatcagtggttatatcaacagcaactgctcactgcccct |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || ||||||||| ||||||||||| |
|
|
| T |
50253032 |
aaggctcaaaactcggactgcatcagtggttatagcagcagcaactgttcactgcccct |
50252974 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University