View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13856_low_9 (Length: 396)
Name: NF13856_low_9
Description: NF13856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13856_low_9 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 39 - 313
Target Start/End: Original strand, 34674209 - 34674486
Alignment:
| Q |
39 |
tttctatgatttgtgctcttttgagtaaagtaacggttgcttgacataaaatggatccttttgaaaagacactatttagggctttgcccaatttctatgc |
138 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
34674209 |
tttctatgatttgtgctcttttgagtaaggtaacggttgcttgacacaaaatggatccttttgaaaagacactatttagggctttgcccaatttatatgc |
34674308 |
T |
|
| Q |
139 |
ttttattttatga---tgtagttctttgctgcagccagatctttggttcgatttatttagttttgtgatgaaatctatatatataacttttttcttggtc |
235 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||| ||||||| |
|
|
| T |
34674309 |
ctttattttatgatgatgtagttctttgctgcagccagatctttggttcaatttatttagttttgcgatgaaatctatatatataactttttacttggtc |
34674408 |
T |
|
| Q |
236 |
atgtggagctgaattccggaagaagaaagatacatatatacatgtaagttttgctatatgcactagtgaagaagaaga |
313 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
34674409 |
atgtagagctgaattccggacgaagaaagatacatatatacatgtaagttttgctgtatgcactagtgaagaagaaga |
34674486 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University