View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13858_high_2 (Length: 472)
Name: NF13858_high_2
Description: NF13858
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13858_high_2 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 362; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 362; E-Value: 0
Query Start/End: Original strand, 18 - 467
Target Start/End: Original strand, 43906086 - 43906522
Alignment:
| Q |
18 |
agagagagaactacacactcacataaaccaatcacggtggtctacagtccgagtgcacgcaatatttaatcccaactgttgttttgagatcagacaattg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43906086 |
agagagagaactacacactcacataaaccaatcacggtcgtctgcagtccgagtgcacgtaatatttaatcccaactgttgttttgagatcagacaattg |
43906185 |
T |
 |
| Q |
118 |
ataaacgcgtcacgtgtcactgacacaattacaccggaaaatctatttaccacacacatgatttatgatttggtttatacagaaagcaaagccaatttcg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43906186 |
ataaacgcgtcacgtgtcactgacacaattacaccggaaaatctatttaccacacacatgatttatgatttggtttatacagaaagcaaagccaatttcg |
43906285 |
T |
 |
| Q |
218 |
tattttatttatttttggtgattagaagaatgatgcatatttatcggtttcttgtgtaggaaactttcatagaagtctcttannnnnnnngtaacaacca |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| || |
|
|
| T |
43906286 |
tattttatttatttttggtgattagaagaatgatgcatatttatcggtttcttgtgtaagaaactttcatagaagtctcttattttttttgt-------- |
43906377 |
T |
 |
| Q |
318 |
cgtgctctctaacacaaataccctttcattcctttcatttttctttcattctttacgtctttcaatttatagattctggcactgacaaatttcatgacca |
417 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43906378 |
-----tctctaacacaaataccctttcattcctttcatttttctttcattctttacgtctttcaatttatagattctggcactgacaaatttcatgacca |
43906472 |
T |
 |
| Q |
418 |
ttcctctttttcttttgttccaaaatgtcacatgaatcacctatgcttct |
467 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
43906473 |
ttcctctttttcttttgttccaaaatgtcacatgaatcacctatgattct |
43906522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University