View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13858_low_4 (Length: 300)
Name: NF13858_low_4
Description: NF13858
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13858_low_4 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 103; Significance: 3e-51; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 15 - 117
Target Start/End: Original strand, 1663568 - 1663670
Alignment:
| Q |
15 |
atgaagaagagtgagagtggtggatatgtgagagcagatcaaatagatctgaagagtttagatgaacaattacaaaggcatcttagtagagcatggacta |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1663568 |
atgaagaagagtgagagtggtggatatgtgagagcagatcaaatagatctgaagagtttagatgaacaattacaaaggcatcttagtagagcatggacta |
1663667 |
T |
|
| Q |
115 |
tgg |
117 |
Q |
| |
|
||| |
|
|
| T |
1663668 |
tgg |
1663670 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 171 - 257
Target Start/End: Original strand, 1663724 - 1663810
Alignment:
| Q |
171 |
tcttcttctaatagtaatacaagaaatagacaagaatgggagattgatccttctaaacttattatcaaaactgtcattgctcgtggt |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1663724 |
tcttcttctaatagtaatacaagaaatagacaagaatgggagattgatccttctaaacttattatcaaaactgtcattgctcgtggt |
1663810 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 15 - 113
Target Start/End: Complemental strand, 31046776 - 31046676
Alignment:
| Q |
15 |
atgaagaagagtgagagtggtggatatgtgagagcagatcaaatagatctgaagagtttagatgaacaattacaaaggcatctt--agtagagcatggac |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||| |
|
|
| T |
31046776 |
atgaagaagagtgagagtggtggatatgtgagagcagatcaaatagatctgaagagtttagacgaacaattacaaaggcatcttacagtagagcatggac |
31046677 |
T |
|
| Q |
113 |
t |
113 |
Q |
| |
|
| |
|
|
| T |
31046676 |
t |
31046676 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 207 - 256
Target Start/End: Original strand, 43970824 - 43970873
Alignment:
| Q |
207 |
tgggagattgatccttctaaacttattatcaaaactgtcattgctcgtgg |
256 |
Q |
| |
|
||||| ||||||||||||||||| || ||||||| ||| ||||||||||| |
|
|
| T |
43970824 |
tgggaaattgatccttctaaactcatcatcaaaagtgttattgctcgtgg |
43970873 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University