View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13858_low_5 (Length: 248)
Name: NF13858_low_5
Description: NF13858
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13858_low_5 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 14 - 248
Target Start/End: Complemental strand, 20624985 - 20624751
Alignment:
| Q |
14 |
atcaaaaaataaaacagtcacaaagttaaattataatcaaacaaaagacgcaccaaactttatggaatattttagaaattcattgtacaaatatagtagg |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20624985 |
atcaaaaaataaaacagtcacaaagttaaattataatcaaacaaaagacacgtcaaactttatggaatattttagaaattcattgtacaaatatagtagg |
20624886 |
T |
 |
| Q |
114 |
ttgctttgaccttaccttgactgaggttcttttcacaagaagatccatgatacccgtttcagcttcttgagcagcgactttttccttcttgattgaacca |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
20624885 |
ttgctttgaccttaccttgactgaggttcttttcacaagaagatccatgatacccatttcaccttcttgagcagcgactttttccttgttgattgaacca |
20624786 |
T |
 |
| Q |
214 |
acacaaggctttcgtatgccaaacttaggagccac |
248 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| |
|
|
| T |
20624785 |
acacaaggctttcgtatgccaaacttaggtgccac |
20624751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University