View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13859_high_1 (Length: 551)
Name: NF13859_high_1
Description: NF13859
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13859_high_1 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 341; Significance: 0; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 341; E-Value: 0
Query Start/End: Original strand, 180 - 532
Target Start/End: Complemental strand, 45328104 - 45327752
Alignment:
| Q |
180 |
attctatttatttggctgttatgtctgttacaacggttggttatggtgatagagcttttaagacacttccgggacgattgtttgcggcgatttggttgtt |
279 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45328104 |
attctatttatttggctgttatgtctgttacaacggttggttatggtgatagagcttttaagacacttccgggacgattgtttgcggcgatttggttgtt |
45328005 |
T |
 |
| Q |
280 |
gttttctactttgatggttgcaagggcttttctttatttagctgaagctagaattgatagaagacataggagattggctaagaaggttttgcatagagaa |
379 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45328004 |
gttttctactttgatggttgcaagggcttttctttatttagctgaagctagaattgatagaagacataggagattggctaagaaggttttgcatagagaa |
45327905 |
T |
 |
| Q |
380 |
attactattgaagattggcttgctgctgatatcaacaatactggttttatcaggtaacctaatagtccattaccctctttataattataggtcaaatcca |
479 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
45327904 |
attactattgaagattggcttgctgctgatatcaacaatactggttttattaggtaacctaatagtcctttaccctctttataattataggtcaaatcca |
45327805 |
T |
 |
| Q |
480 |
tagttcttgtaattgcaatgtaaaagatttatttagatatctctgcaactgta |
532 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
45327804 |
tagttcttgtaattgcaatgtaaaggatttatttagatatctctgcaactgta |
45327752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 89; E-Value: 1e-42
Query Start/End: Original strand, 1 - 93
Target Start/End: Complemental strand, 45328283 - 45328191
Alignment:
| Q |
1 |
tttaacagggcttcaaatgggtgctagagaagggtttactgctagggattatatagttgatgttgcaaaaggtaggatgagaattaggttgaa |
93 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45328283 |
tttaaccgggcttcaaatgggtgctagagaagggtttactgctagggattatatagttgatgttgcaaaaggtaggatgagaattaggttgaa |
45328191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University