View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13860_high_31 (Length: 275)
Name: NF13860_high_31
Description: NF13860
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13860_high_31 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 1 - 254
Target Start/End: Complemental strand, 45530470 - 45530217
Alignment:
| Q |
1 |
tgtgtggtcacagatcctaaatctgcagtaagctagatgttttctagttaacaattattgagaagaaaaagatgcataacaaccggtttaataaatgcca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45530470 |
tgtgtggtcacagatcctaaatctgcagtaagctagatgttttctagttaacaattattgagaagaaaaagatgcataacaaccggtttaataaatgcca |
45530371 |
T |
|
| Q |
101 |
tcaaaagcaaactactgatcatagctcagaaggtttctcagaaaaaaggggattgcattggtgattcggagtttggcctcaaggcaagtttgaccaatga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45530370 |
tcaaaagcaaactactgatcatagctcagaaggtttctcagaaaaaaggggattgcattggtgattcggagtttggcctcaaggcaagtttgaccaatga |
45530271 |
T |
|
| Q |
201 |
tagttcaaataagggattgaactcaagtactcttcatcaattcaaccttacctg |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45530270 |
tagttcaaataagggattgaactcaagtactcttcatcaattcaaccttacctg |
45530217 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University