View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13860_high_33 (Length: 249)
Name: NF13860_high_33
Description: NF13860
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13860_high_33 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 10 - 224
Target Start/End: Complemental strand, 37667255 - 37667041
Alignment:
| Q |
10 |
gtagcataggcaaccaaaatttttagagattttttattagggatagtattaaatgaagtttgaaaaggagatttatgttgcaatagaggtgtgatgactc |
109 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37667255 |
gtagcataagcaaccaaaatttttagagattttttattagggatagtattaaatgaagtttgaaaaggagatttatgttgcaatagaggtgtgatgactc |
37667156 |
T |
 |
| Q |
110 |
tattgattaagaacacaacattaataaacatatgatccaaatgacttaggtaatttggactgaaatataatggttcttcctacattgagaatttgttggt |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37667155 |
tattgattaagaacacaacattaataaacatatgatccaaatgacttaggtaatttggactgaaatataatggttcttcctacattgagaatttgttggt |
37667056 |
T |
 |
| Q |
210 |
gtaccattttgtcgt |
224 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
37667055 |
gtaccattttgtcgt |
37667041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University