View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13860_high_38 (Length: 202)
Name: NF13860_high_38
Description: NF13860
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13860_high_38 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 1 - 189
Target Start/End: Original strand, 45047749 - 45047937
Alignment:
| Q |
1 |
taacacccctttgaacatgttcatgtcgtcaacaccaataatatgtgtttttctcctatatatagttgtttgcaatttctcgagcttgatcaaagacgaa |
100 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45047749 |
taacacgcctttgaacatgttcatgtcgtcaacaccaataatatttgtttttctcctatatatagttgtttgcaatttctcgagcttgatcaaagacgaa |
45047848 |
T |
 |
| Q |
101 |
ttgaatgaagcccgtatgaatcttagtagacaatattctcatgaatattggccacccaaaattctatccactatgacacttttggattc |
189 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
45047849 |
ttgaatgaagcccgtatgaatcttagtaggcaatattctaatgaatattggccagccaaaattctatccactatgacacttttggattc |
45047937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University