View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13860_low_23 (Length: 357)
Name: NF13860_low_23
Description: NF13860
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13860_low_23 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 310; Significance: 1e-174; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 310; E-Value: 1e-174
Query Start/End: Original strand, 13 - 346
Target Start/End: Complemental strand, 37994360 - 37994027
Alignment:
| Q |
13 |
gaacattgaagcatcacccttaaacgcgttccatgacaagtccaaaatctgcaaattcagcttccccagagacgctggaatcttcccggagagacggttt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37994360 |
gaacattgaagcatcacccttaaacgcgttccatgacaagtccaaaatctgcaaattcagcttccccagagacgctggaatcttcccggagagacggttt |
37994261 |
T |
|
| Q |
113 |
cgcgacagatccaaccctacaaaagatttcgggaatgagccgtatgacttcggtattgctccggttagctggtttctatagaagaagattccagcgaggt |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37994260 |
cgcgacagatccaaccctacaaaagatttcgggaatgagccgtatgacttcggtattgctcctgttagctggtttctatagaagaagattccagcgaggt |
37994161 |
T |
|
| Q |
213 |
ttgggagagttgagagtgatgcagggaggggaccagtgagtttgttgtcgctgatgtcgatgcttactagggttttgatctctgagagagtgttaggtat |
312 |
Q |
| |
|
| || ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37994160 |
taggtagagttgagagtgatgcggggaggggaccagtgagtttgttgtcgctgatgtcgatggttactagggttttgatctctgagagagtgttaggtat |
37994061 |
T |
|
| Q |
313 |
ctcgccggagatgttggtttggatgatgttgatg |
346 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| |
|
|
| T |
37994060 |
ctcgccggagatgttggtttggatgatgtagatg |
37994027 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 199 - 341
Target Start/End: Complemental strand, 37989990 - 37989848
Alignment:
| Q |
199 |
gattccagcgaggtttgggagagttgagagtgatgcagggaggggaccagtgagtttgttgtcgctgatgtcgatgcttactagggttttgatctctgag |
298 |
Q |
| |
|
||||||||||||| |||||| |||||||||||| || ||||||||||| |||||||||||| ||| | |||| ||||||| |||||||||| |||| |
|
|
| T |
37989990 |
gattccagcgagggttgggatagttgagagtgaagcggggaggggaccggtgagtttgttgctattgaaggagatggttactagtgttttgatctgtgag |
37989891 |
T |
|
| Q |
299 |
agagtgttaggtatctcgccggagatgttggtttggatgatgt |
341 |
Q |
| |
|
||||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
37989890 |
agagtgtaaggtatctccccggagatgttggtttggatgatgt |
37989848 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 224 - 330
Target Start/End: Original strand, 37697403 - 37697509
Alignment:
| Q |
224 |
gagagtgatgcagggaggggaccagtgagtttgttgtcgctgatgtcgatgcttactagggttttgatctctgagagagtgttaggtatctcgccggaga |
323 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| | ||| |||||| | || ||||||||| || | ||| |||||||| |||||||||||||||| |
|
|
| T |
37697403 |
gagagtgaagcagggaggggaccagtgagtttgttgttggtgaagtcgatccgtaatagggttttcatatttgaaagagtgtttggtatctcgccggaga |
37697502 |
T |
|
| Q |
324 |
tgttggt |
330 |
Q |
| |
|
|| |||| |
|
|
| T |
37697503 |
tgctggt |
37697509 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 236 - 330
Target Start/End: Complemental strand, 38013671 - 38013577
Alignment:
| Q |
236 |
gggaggggaccagtgagtttgttgtcgctgatgtcgatgcttactagggttttgatctctgagagagtgttaggtatctcgccggagatgttggt |
330 |
Q |
| |
|
|||||||||||||| |||||||||| | || |||||||| || || |||||||||| |||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
38013671 |
gggaggggaccagttagtttgttgttgtagaagtcgatgcgtaagagcgttttgatctgtgagagggtgtttggtatctcgccggagatgttggt |
38013577 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University