View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13860_low_38 (Length: 205)
Name: NF13860_low_38
Description: NF13860
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13860_low_38 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 142; Significance: 1e-74; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 1 - 190
Target Start/End: Complemental strand, 40773282 - 40773092
Alignment:
| Q |
1 |
tattaacatctacattttgtggctgtggtgaatctgctaatgaagcagatattagtttctgcattacttctctaaagtaatagnnnnnnn-catagccac |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| | ||||||| |
|
|
| T |
40773282 |
tattaacatctacattttgtggctgtggtgaatctgctaatgaagcagatgttagtttctgcattacttctctaaagtaatagaaaaaaaacttagccac |
40773183 |
T |
 |
| Q |
100 |
ttcgattattttatagttttaattttaactattctttttattgcctagttgcttcactatgaaccactacattttattggtgcaatgacag |
190 |
Q |
| |
|
||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
40773182 |
ttcgattattttatagttttaatataaactattctttttattgcctagttgcttcactatgaaacactacattttattggtgcaatgacag |
40773092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 7 - 66
Target Start/End: Complemental strand, 40780677 - 40780619
Alignment:
| Q |
7 |
catctacattttgtggctgtggtgaatctgctaatgaagcagatattagtttctgcatta |
66 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||| || ||||||||| ||||||| |
|
|
| T |
40780677 |
catctacattttgtggctgtagtgaatctgctaattaagtag-tattagtttgtgcatta |
40780619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University