View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13861_high_10 (Length: 297)
Name: NF13861_high_10
Description: NF13861
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13861_high_10 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 260; Significance: 1e-145; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 19 - 282
Target Start/End: Original strand, 48083304 - 48083567
Alignment:
| Q |
19 |
taatttaagagcaatgatcattgagcaattatgtgaggcacttgaattttcttcattcggcggtttgctttaaatcactgggaggtgtggtagaaaataa |
118 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48083304 |
taatttaagaccaatgatcattgagcaattatgtgaggcacttgaattttcttcattcggcggtttgctttaaatcactgggaggtgtggtagaaaataa |
48083403 |
T |
 |
| Q |
119 |
cattaatgagtgttatttacagaatgtgtgaattcaaccttatatatacccttctcatttgcatgttccatacaaaccacgagttatcaaattgatacat |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48083404 |
cattaatgagtgttatttacagaatgtgtgaattcaaccttatatatacccttctcatttgcatgttccatacaaaccacgagttatcaaattgatacat |
48083503 |
T |
 |
| Q |
219 |
cacatacaatttagtaacacttctcagtcctctcaattattttgcattgcaatggctacttctt |
282 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48083504 |
cacatacaatttagtaacacttctcagtcctctcaattattttgcattgcaatggctacttctt |
48083567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University