View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13862_low_29 (Length: 247)
Name: NF13862_low_29
Description: NF13862
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13862_low_29 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 96; Significance: 3e-47; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 95 - 241
Target Start/End: Original strand, 42637080 - 42637218
Alignment:
| Q |
95 |
cagaatactgtaaatgagataagcaatgaaatcataataatcataagaaattaataaccacgttcatgataaaataaag-aaattaatgaatttcttctc |
193 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
42637080 |
cagaatactgtaaatgagatatgcaatgaaatcataa---------gaaattaataaccacgttcatgataaaataaaataaattaatgaatttattctc |
42637170 |
T |
|
| Q |
194 |
tttcaatcgacacaaggctttccttgtaagttattatctgagaataat |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42637171 |
tttcaatcgacacaaggctttccttgtaagttattatctgagaataat |
42637218 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 31
Target Start/End: Original strand, 42636986 - 42637016
Alignment:
| Q |
1 |
tttctacatcaaactttaagttgttgacatg |
31 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
42636986 |
tttctacatcaaactttaagttgttgacatg |
42637016 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University