View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13862_low_33 (Length: 220)
Name: NF13862_low_33
Description: NF13862
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13862_low_33 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 16 - 203
Target Start/End: Original strand, 11501324 - 11501511
Alignment:
| Q |
16 |
cagacaataaacacactcaagtataggaagcccacagataaatgacatcaatgcctatacttcaattcaatcatgttgacaaatgttccagaccaaaata |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11501324 |
cagacaataaacacactcaagtataggaagcccacagataaatgacatcaatgcctacacttcaattcaatcatgttgacaaatgttccagaccaaaata |
11501423 |
T |
 |
| Q |
116 |
acagttcacacactagggttggatttggatcaggtaataacccgtgttgtcaacagtgaatcgcggaaaataacagtttgttcaaatt |
203 |
Q |
| |
|
|||||||| |||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11501424 |
acagttcagacactaggattggatttggatcaggtaataacccgtattgtcaacagtgaatcgcggaaaataacagtttgttcaaatt |
11501511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University