View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13863_high_11 (Length: 239)
Name: NF13863_high_11
Description: NF13863
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13863_high_11 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 10 - 228
Target Start/End: Original strand, 16471752 - 16471970
Alignment:
| Q |
10 |
aagactatgcagagcatgaaggggttgattttaattgtcccttcacagtatttgacttttttcttgcttcaccagtgccaaactaattgatattatatag |
109 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16471752 |
aagaatatgcagagcatgaaggggttgattttaatcgtcccttcacagtatttgacttttttcttgcttcaccagtgccaaactaattgatattatatag |
16471851 |
T |
 |
| Q |
110 |
catatgaaattctgggggagatttgatatgtctataggaccaggatccatgcaatccgagtgtactcttattcattgaaaatattcaattgacttcaatt |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16471852 |
catatgaaattctgggggagatttgatatgtctataggaccaggatccatgcaatccgagtgtactcttattcattgaaaatattcaattgacttcaatt |
16471951 |
T |
 |
| Q |
210 |
tgaggagatggttgatttt |
228 |
Q |
| |
|
||| ||||||||||||||| |
|
|
| T |
16471952 |
tgacgagatggttgatttt |
16471970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University