View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13863_low_16 (Length: 209)
Name: NF13863_low_16
Description: NF13863
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13863_low_16 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 46 - 196
Target Start/End: Original strand, 7095329 - 7095479
Alignment:
| Q |
46 |
gtgcctttcccattttatcttcaccatgttttatccctttgtatgggtcctaaacaacatgggttgcccgtgatatgggaccacaacaactcacaagatc |
145 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
7095329 |
gtgcctttcccattttatcttcaccatgttttatccctttgtatgggtcctaaacaacatgggttgcccgtgatatgggaccacaacaattcacaagatc |
7095428 |
T |
|
| Q |
146 |
caaatctaatccacgggtttctttttaggtcactaatcaatccttcttctc |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7095429 |
caaatctaatccacgggtttctttttaggtcactaatcaatccttcttctc |
7095479 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University