View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13864_high_50 (Length: 274)
Name: NF13864_high_50
Description: NF13864
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13864_high_50 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 18 - 253
Target Start/End: Complemental strand, 41028871 - 41028644
Alignment:
| Q |
18 |
aagataagggacgggaagggaattgaagaaggaagtgtttgggttttagaatggtggtggttgaattgggtttgatagttgtaggagaaatgaagtttgg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
41028871 |
aagataagggacgggaagggaattgaagaaggaagtgtttgggttttagaatggtggtggttgaattgggtttgatagttgtaggagaaatgaagtgtgg |
41028772 |
T |
 |
| Q |
118 |
aagagtaacaaatggcaaagccattcagagactgtagagtaagctaatggaatggattatgtgaactcaagaagaaaaggagtgagtgtgtgtgaggtaa |
217 |
Q |
| |
|
|||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
41028771 |
aagagtaacaaatgtcaaagccattc--agactgtagagtaagctaatggaatggattatgtgaactcaagaagaaaagtagtga------gtgaggtaa |
41028680 |
T |
 |
| Q |
218 |
ggggtttgtatggggttttagtttcaagttttactt |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
41028679 |
ggggtttgtatggggttttagtttcaagttttactt |
41028644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University