View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13864_high_53 (Length: 257)
Name: NF13864_high_53
Description: NF13864
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13864_high_53 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 111; Significance: 4e-56; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 132 - 242
Target Start/End: Original strand, 13251394 - 13251504
Alignment:
| Q |
132 |
tacatggatacatattgtatttttccgtatggcattggtttcttgattgatgaaacactgaaattgttttgtttggagttttagtcaagtttgtcttttg |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13251394 |
tacatggatacatattgtatttttccgtatggcattggtttcttgattgatgaaacactgaaattgttttgtttggagttttagtcaagtttgtcttttg |
13251493 |
T |
|
| Q |
232 |
tgtttggttat |
242 |
Q |
| |
|
||||||||||| |
|
|
| T |
13251494 |
tgtttggttat |
13251504 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 9 - 96
Target Start/End: Complemental strand, 13141392 - 13141305
Alignment:
| Q |
9 |
gcagaacctgtgtgataatgataataatcaatcaaacataactgaagtactcaaacgaaccaccaccatgacacaagtttgacattct |
96 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13141392 |
gcagcacctgtgtgataatgataataatcaatcaaacataactgaagtactcaaacgaaccaccaccatgacacaagtttgacattct |
13141305 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 87 - 130
Target Start/End: Complemental strand, 13141180 - 13141137
Alignment:
| Q |
87 |
ttgacattctcccaaccaaaaagattaatttgattgaagatttt |
130 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13141180 |
ttgaaattctcccaaccaaaaagattaatttgattgaagatttt |
13141137 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University