View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13864_high_57 (Length: 243)
Name: NF13864_high_57
Description: NF13864
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13864_high_57 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 31 - 228
Target Start/End: Original strand, 1591030 - 1591229
Alignment:
| Q |
31 |
tttcttctggttttggatgaggaattatgagagggtatgaaggggtatatatatgtgtcaaaagtggatacgaggctaaaataaaacaagaggaaaatac |
130 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1591030 |
tttcttctggttttggatgaggaattatgagagggtatgaaggggtatatatatgtgtcaaaagtggatacgaggctaaaataaaacaagaggaaaatac |
1591129 |
T |
|
| Q |
131 |
tctttg-tttgaagtggaagaattgaaagtgatgtatatgctgcatgtttcactttggcatatagaatctatagttttgt-ggggcatagcgttttttat |
228 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
1591130 |
tctttgttttgaagtggaagaattgaaagtgatgtatatgctgcatgtttcactttggcatatagaatctatagttttgtgggggcatagcgttttttat |
1591229 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University