View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13864_low_25 (Length: 424)

Name: NF13864_low_25
Description: NF13864
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13864_low_25
NF13864_low_25
[»] chr7 (2 HSPs)
chr7 (1-251)||(12874693-12874939)
chr7 (350-409)||(12874548-12874607)


Alignment Details
Target: chr7 (Bit Score: 148; Significance: 6e-78; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 148; E-Value: 6e-78
Query Start/End: Original strand, 1 - 251
Target Start/End: Complemental strand, 12874939 - 12874693
Alignment:
1 ataaaagtgatatgaggataataaaatatcagcttattgactgacca------tgcttttaacgtgattggataaacgtatatttaaagtgcttttggga 94  Q
    ||||||||||| |||||||||||||||||||||||||||||||||||      |||||||||||||||||||||||||||||||||||||||||||||||    
12874939 ataaaagtgatttgaggataataaaatatcagcttattgactgaccaagaccatgcttttaacgtgattggataaacgtatatttaaagtgcttttggga 12874840  T
95 gagatgccaggtactactaccaactgacggatcacattcatatctgttattgtccataataatgcaaattatgaaattgataaaaaaggatagtaaagga 194  Q
    ||  ||||||    ||| || ||||| ||||||||||||| || ||||||||| |||||||||||||||||   ||||||||||||||||||||||||||    
12874839 ga--tgccag----tac-actaactgtcggatcacattcacatttgttattgttcataataatgcaaatta---aattgataaaaaaggatagtaaagga 12874750  T
195 aagaaataaatatttgtacgaaaagaataagatagtaagggaaagatttcttttttt 251  Q
    |||||||||||||||||||||||| |||| |||||||| ||||||||||||||||||    
12874749 aagaaataaatatttgtacgaaaataatacgatagtaaaggaaagatttcttttttt 12874693  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 350 - 409
Target Start/End: Complemental strand, 12874607 - 12874548
Alignment:
350 ttaagtatgcaatagacaaatatgaacctggactagaaaacatctacatacgtaattatt 409  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
12874607 ttaagtatgcaatagacaaatatgaacctggactagaaaacatctacatacgtaattatt 12874548  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University