View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13864_low_41 (Length: 342)
Name: NF13864_low_41
Description: NF13864
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13864_low_41 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 160; Significance: 3e-85; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 160; E-Value: 3e-85
Query Start/End: Original strand, 1 - 176
Target Start/End: Original strand, 13141364 - 13141539
Alignment:
| Q |
1 |
gattattatcattatcacacaggtgctgcaaaatctggctgcatcagatgatgactttgagaaactacggctccatgtgactacaccacttcagctttca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13141364 |
gattattatcattatcacacaggtgctgcaaaatctggctgcatcatatgatgactttgagaaactacggctccatgtgactacaccacttcagctttca |
13141463 |
T |
 |
| Q |
101 |
acattacctggtgcagcaatggaactagattggggttagtttatggatggcttttcttatcaggattcatcttcta |
176 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
13141464 |
acattacctggtgcagaaatggaactagattggggttagtttatggacagcttttcttatcaggattcatcttcta |
13141539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 210 - 338
Target Start/End: Original strand, 13142095 - 13142223
Alignment:
| Q |
210 |
tacattgatacattttgtttctctggatcattagaaggacatacatttccgcatcaataaagagtgttgtgcattagttttgtttacctcgaacggtgct |
309 |
Q |
| |
|
|||||| ||||||| |||||||| | |||||||||||| |||||||||| || |||||||| ||||| ||||||||||||||||| | |||||||| | |
|
|
| T |
13142095 |
tacatttatacattctgtttctccgtatcattagaagggcatacatttctgcttcaataaaaagtgtcatgcattagttttgtttaacgagaacggtgat |
13142194 |
T |
 |
| Q |
310 |
atgcttgtattttattcatctactctctg |
338 |
Q |
| |
|
||| |||||||||| ||| |||||||||| |
|
|
| T |
13142195 |
atgtttgtattttactcacctactctctg |
13142223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University