View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13864_low_44 (Length: 324)
Name: NF13864_low_44
Description: NF13864
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13864_low_44 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 278; Significance: 1e-155; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 278; E-Value: 1e-155
Query Start/End: Original strand, 18 - 314
Target Start/End: Complemental strand, 30936948 - 30936652
Alignment:
| Q |
18 |
acaaattagtgacaattcattattataccattaaaaatttgaattgattttgagtcacatgaaccatcttaaa-tcaaagcaccacctttatatgcattt |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||| |
|
|
| T |
30936948 |
acaaattagtgacaattcattattataccattaaaaatttgaattgattttgagtcacatgaaccatcttaaaatcaaagcaccacctttatctgcattt |
30936849 |
T |
 |
| Q |
117 |
gttcaattggttaagcaaggaaataggaacaaaagcagcatatactaatactaaagaccaacattgcaaatccatgttgtattacccacttgaacagaat |
216 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30936848 |
gttcaattggttaagcaaggaaatag-aacaaaagcagcatatactaatactaaagaccaacattgcaaatccatgttgtattacccacttgaacagaat |
30936750 |
T |
 |
| Q |
217 |
caaaacacatgcaaaggtcccctaaaacgtgggaccctatactaccgtaacaaaattgtcacatgtattcacatgatgggtatggaatgccatctctg |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30936749 |
caaaacacatgcaaaggtcccctaaaacgtgggaccctatactaccgtaacaaaattgtcacatgtattcacatgatgggtatggaatgccatctctg |
30936652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University