View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13864_low_60 (Length: 245)
Name: NF13864_low_60
Description: NF13864
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13864_low_60 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 207
Target Start/End: Original strand, 43585465 - 43585671
Alignment:
| Q |
1 |
gagaaacaaagtggtgtggtttcattatctaggcaaatagaacttgaaaaccttcttagcatattgttgttgactttttatattttggtatttgtaaaca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43585465 |
gagaaacaaagtggtgtggtttcattatctaggcaaatagaacttgaaaaccttcttagcatattgttgttgactttttatattttggtatttgtaaaca |
43585564 |
T |
 |
| Q |
101 |
ggtgaaattctaaacaaaccctgatgaggtcagagtttcacacaagttgcagtgttacaaaaatatttcttaatcagagtacaattatagtaggaatggg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43585565 |
ggtgaaattctaaacaaaccctgatgaggtcagagtttcacacaagttgcagtgttacaaaaatatttcttaatcagagtacaattatagtaggaatggg |
43585664 |
T |
 |
| Q |
201 |
attaggg |
207 |
Q |
| |
|
||||||| |
|
|
| T |
43585665 |
attaggg |
43585671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University