View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13864_low_63 (Length: 240)

Name: NF13864_low_63
Description: NF13864
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13864_low_63
NF13864_low_63
[»] chr8 (1 HSPs)
chr8 (193-240)||(42248305-42248352)


Alignment Details
Target: chr8 (Bit Score: 48; Significance: 1e-18; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 193 - 240
Target Start/End: Original strand, 42248305 - 42248352
Alignment:
193 ttaaattgaaattatgtaaatccctttctaagcttatgttaaatttct 240  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||    
42248305 ttaaattgaaattatgtaaatccctttctaagcttatgttaaatttct 42248352  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University