View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13864_low_64 (Length: 238)

Name: NF13864_low_64
Description: NF13864
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13864_low_64
NF13864_low_64
[»] chr3 (1 HSPs)
chr3 (104-178)||(35867052-35867126)


Alignment Details
Target: chr3 (Bit Score: 47; Significance: 6e-18; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 104 - 178
Target Start/End: Complemental strand, 35867126 - 35867052
Alignment:
104 ttgatatggttaggatttttatccgtccacataatttagnnnnnnnngttagacctaatttttgtggtgtacatg 178  Q
    |||||||||||||||||||||||||||||||||||||||        |||||||||||||||||| |||||||||    
35867126 ttgatatggttaggatttttatccgtccacataatttagttttttttgttagacctaatttttgtcgtgtacatg 35867052  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University