View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13866_low_15 (Length: 348)
Name: NF13866_low_15
Description: NF13866
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13866_low_15 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 290; Significance: 1e-163; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 290; E-Value: 1e-163
Query Start/End: Original strand, 18 - 343
Target Start/End: Complemental strand, 1837306 - 1836972
Alignment:
| Q |
18 |
aaaggggtgtgacatttgcatccatgtaggaggagaatccataggcgaatcattaatcgcttgaatttgacttggagagagtctgaccctcagaggcgcc |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1837306 |
aaaggggtgtgacatttgcatccatgtaggaggagaatccataggcgaatcgttaatcgcttgaatttgacttggagagagtctgaccctcagaggcgcc |
1837207 |
T |
|
| Q |
118 |
accgcatcagtggaactggctgagc---ctgttccactgttgttatctggtggcgccaacatgttgg------ctctcaacctcaaggcggcttcatgtg |
208 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
1837206 |
accgcatcagtggaactggctgagcagcctgttccactgttgttatctagtggcgccaacatgttggtgttggctctcaacctcaaggcggcttcatgtg |
1837107 |
T |
|
| Q |
209 |
ctgccattcgaatgtggtcagcattgttgcttagaggacgaggaagagtgtttgcaagttccgggaaattgagcctggcttcacgtcccctgaaatgcaa |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1837106 |
ctgccattcgaatgtggtcagcattgttgcttagaggacgaggaagagtgtttgcaagttccgggaaattgagcctggcttcacgtcccctgaaatgcaa |
1837007 |
T |
|
| Q |
309 |
ggcagctacgtcgtatgcagccgctgccatctctg |
343 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
1837006 |
ggcagctacgtcgtatgcagccgctgccatctctg |
1836972 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University