View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13866_low_17 (Length: 325)
Name: NF13866_low_17
Description: NF13866
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13866_low_17 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 301; Significance: 1e-169; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 301; E-Value: 1e-169
Query Start/End: Original strand, 1 - 317
Target Start/End: Complemental strand, 21235511 - 21235195
Alignment:
| Q |
1 |
gttccagtttgaggacgtccgccgtgtctggttcggaagttgttaagaagccgttgagtaagccggctttgtcgagggatagagttggttcttccacagt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21235511 |
gttccagtttgaggacgtccgccgtgtctggttcggaagttgttaagaagccgttgagtaagccggctttgtcgagggatagagttggttcttccacagt |
21235412 |
T |
|
| Q |
101 |
ggatggttccgttaggaagaccgtggggaaggtttcgtcgccgtcattgtcggcgcggtcaccaactgtttctggtggattgagggcggggtctgtgtca |
200 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21235411 |
ggatggttccgttaggaagactgtggggaaggtttcgtcgcagtcattgtcggcgcggtcaccaactgtttctggtggattgagggcggggtctgtgtca |
21235312 |
T |
|
| Q |
201 |
tcttcttcggatagaagttctggtttgtctggaaggaggaaagtgacgacgacccctgacagtcgtaactcgcggttaattgttcttccgcagattgagg |
300 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21235311 |
tcgtcttcggatagaagttctggtttgtctggaaggaggaaagtgacgacgacccctgatagtcgtaactcgcggttaattgttcttccgcagattgagg |
21235212 |
T |
|
| Q |
301 |
ttaaagctagtgatgat |
317 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
21235211 |
ttaaagctagtgatgat |
21235195 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University