View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13866_low_22 (Length: 298)
Name: NF13866_low_22
Description: NF13866
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13866_low_22 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 15 - 290
Target Start/End: Complemental strand, 13144167 - 13143892
Alignment:
| Q |
15 |
aaaccaaccggactaacctctagaattgggcaaattgagagccattaatccaacgttccaatgtaataacttttaatccaagtcactactacatcttccc |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13144167 |
aaaccaaccggactaacctctagaattgggcaaattgagagccattaatccaacgttccaatgtaataacttttaatccaagtcactactacatcttccc |
13144068 |
T |
|
| Q |
115 |
ctccaggtgtgtatattaatttcattgtgtgatcactaggacaattgccaaatataatatatataatcagaaagtaatatgaaaattttgattaactact |
214 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
13144067 |
ctccaggtgtgtatattaatttcaatgtgtgatcactaggacaattgccaaatataatatatataatcagaaagtaatatgacaattttgattaactact |
13143968 |
T |
|
| Q |
215 |
tttaactacatatgatagctcctaattatgaaggaggatggcaccgtcatcttggaaaataccgtttgatattctt |
290 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
13143967 |
tttaactacatatgatagctcctaatcatgaaggaggatggcaccctcatcttggaaaataccatttgatattctt |
13143892 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University