View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13866_low_24 (Length: 272)
Name: NF13866_low_24
Description: NF13866
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13866_low_24 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 82; Significance: 9e-39; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 82; E-Value: 9e-39
Query Start/End: Original strand, 10 - 91
Target Start/End: Complemental strand, 29298870 - 29298789
Alignment:
| Q |
10 |
aagaatattatgtgatacagcagtttcagctctcggaaaaatctttgagtatcatcgtggcagtatcggccctaaggtaaca |
91 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29298870 |
aagaatattatgtgatacagcagtttcagctctcggaaaaatctttgagtatcatcgtggcagtatcggccctaaggtaaca |
29298789 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 22 - 148
Target Start/End: Complemental strand, 29327486 - 29327360
Alignment:
| Q |
22 |
tgatacagcagtttcagctctcggaaaaatctttgagtatcatcgtggcagtatcggccctaaggtaacaattttccaaaatatcaatagaaaatagatt |
121 |
Q |
| |
|
|||||| |||||| ||||||| |||||||||| ||| | ||| |||| || || |||| ||| ||||| ||| |||||||||||||| ||||||||||| |
|
|
| T |
29327486 |
tgataccgcagttgcagctcttggaaaaatctgtgaatttcaccgtgacaataccggctctatggtaataatcttccaaaatatcaaatgaaaatagatt |
29327387 |
T |
|
| Q |
122 |
ctctacctttgatatttgccaactttg |
148 |
Q |
| |
|
||||| |||||||||||| ||| |||| |
|
|
| T |
29327386 |
ctctatctttgatatttgtcaaatttg |
29327360 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 203 - 255
Target Start/End: Complemental strand, 29298787 - 29298735
Alignment:
| Q |
203 |
tgctgcaactattattctttcatgatcccaaagcaggactggaatatatagga |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
29298787 |
tgctgcaactattattctttcatgatcccaaagcaggacaggaatatatagga |
29298735 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 16 - 104
Target Start/End: Complemental strand, 29316848 - 29316760
Alignment:
| Q |
16 |
attatgtgatacagcagtttcagctctcggaaaaatctttgagtatcatcgtggcagtatcggccctaaggtaacaattttccaaaata |
104 |
Q |
| |
|
|||||| ||||| ||||| ||||||| |||||||||| || | |||||||| || | ||||||||||||||| ||| | |||||||| |
|
|
| T |
29316848 |
attatgcgataccgcagtagcagctcttggaaaaatctacgaatttcatcgtgacaatgtcggccctaaggtaataatctcccaaaata |
29316760 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University