View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13866_low_27 (Length: 249)
Name: NF13866_low_27
Description: NF13866
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13866_low_27 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 55 - 239
Target Start/End: Complemental strand, 49325616 - 49325432
Alignment:
| Q |
55 |
ttgaggtatttaccgcaacgacatacatgaaagatcactttcacatcaactttatgaaggatcacttttgttttcaactccttggaattatattatcttt |
154 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||| ||||||||||||||| |
|
|
| T |
49325616 |
ttgaggtatttaccgcaacgacatacatgaaagatcactttcacatcaactttatgaaggatcatttttgttttcaattccttgaaattatattatcttt |
49325517 |
T |
 |
| Q |
155 |
tgtagtataagccgattgatagaaaggtgattaacgaaaatagatgttagttttcagaggtgatattcctttttattctattcat |
239 |
Q |
| |
|
|||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49325516 |
tgtagtgtaagccgattgatagaaaggtcattaacgaaaatagatgttagttttcagaggtgatattcctttttattctattcat |
49325432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University