View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13866_low_28 (Length: 248)
Name: NF13866_low_28
Description: NF13866
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13866_low_28 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 235
Target Start/End: Complemental strand, 33780235 - 33780000
Alignment:
| Q |
1 |
caatttctcttttctctagctagcacaaatataaggtacactactctccacctaagggccacggtcaagtgagtgattgaggcaaaagcgagtgacaatg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33780235 |
caatttctcttttctctagctagcacaaatataaggtacactactctccacctaagggccacggtcaagtgagtgattgaggcaaaagcgagtgacaatg |
33780136 |
T |
|
| Q |
101 |
tgacatcctaagtatatgagtgaacctatgtgttcagattcaaaggccgtgcaacatgtgctatatag-ttaattgtatgtttgaatgagtggtgagatt |
199 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
33780135 |
tgacatcctaagtatatgagtgaccctatgtgttcagattcaaaggccgtgcaacatgtgctatatagtttaattgtatgtttggatgagtggtgagatt |
33780036 |
T |
|
| Q |
200 |
gataaaatcacaaagttaagaaatgacataacgata |
235 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |
|
|
| T |
33780035 |
gataaaatcataaagttaagaaatgacataacgata |
33780000 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University