View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13866_low_29 (Length: 243)
Name: NF13866_low_29
Description: NF13866
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13866_low_29 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 115; Significance: 2e-58; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 1 - 119
Target Start/End: Original strand, 49325682 - 49325800
Alignment:
| Q |
1 |
aaattaacattgaacaaaatcactttgcataaagtagttgtggttatactcaaatggaaacttcaagtttttgatatagcttttccgataaaagatttta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49325682 |
aaattaacattgaacaaaatcactttgcataaagttgttgtggttatactcaaatggaaacttcaagtttttgatatagcttttccgataaaagatttta |
49325781 |
T |
|
| Q |
101 |
tgataaacgcaagatatca |
119 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
49325782 |
tgataaacgcaagatatca |
49325800 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 177 - 227
Target Start/End: Original strand, 49325858 - 49325908
Alignment:
| Q |
177 |
tccttgataaactaattaaaatatattttatctaggatcagaaatggaaac |
227 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
49325858 |
tccttgataaactaattaaaatatattttatctaggaacagaaatggaaac |
49325908 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University