View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13867_low_22 (Length: 258)
Name: NF13867_low_22
Description: NF13867
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13867_low_22 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 82; Significance: 8e-39; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 11 - 168
Target Start/End: Complemental strand, 37736692 - 37736535
Alignment:
| Q |
11 |
cagagatggtaacgttcatcacgaccattggttccatctccaaacaagtttgtttggaattaccatggttttccagctgtattatccaggaatttgaaat |
110 |
Q |
| |
|
||||||| |||||| || ||||||||| | ||||||| ||||||||||||||||||||| | |||||||||||||||| ||||| ||||||||| |||| |
|
|
| T |
37736692 |
cagagatcgtaacgctcctcacgaccactagttccatttccaaacaagtttgtttggaactgccatggttttccagctttattacccaggaattcaaaat |
37736593 |
T |
 |
| Q |
111 |
tcaaatcatcatgcattcttctgtcgaagacatcaatgcttgtggtctgtaacaacaa |
168 |
Q |
| |
|
| || |||||| ||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
37736592 |
caagttcgtcatgccttcttctatcgaagacatcaatgcttgtggtctgtaacaacaa |
37736535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 213 - 256
Target Start/End: Original strand, 19044561 - 19044604
Alignment:
| Q |
213 |
gagtaataatgcaatgatcagtttctttttgaaccgatttatat |
256 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
19044561 |
gagtaataatgcaatgatcagtttctttttgaaccgattaatat |
19044604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University