View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13867_low_27 (Length: 219)
Name: NF13867_low_27
Description: NF13867
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13867_low_27 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 219
Target Start/End: Original strand, 48942802 - 48943020
Alignment:
| Q |
1 |
tcaccggcttaggcggaagcggccttggccagctcgccgtcgccgttgctgtctctttccttgttcgtatcttctctgcacccggtcccgctctcttacc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48942802 |
tcaccggcttaggcggaagcggccttggccagctcgccgtcgccgttgctgtctctttccttgttcgtatcttctctgcacccggtcccgctctcttacc |
48942901 |
T |
 |
| Q |
101 |
ggaaaacgacgtcgacgacgatgttccaatcaacgacgatgaaactcctccttccaccggaaaggttactccggtcacaatccgttggaacaatattaat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
48942902 |
ggaaaacgacgtcgacgacgatgttccaatcaacgacggtgaaactcctccttccaccggaaaggttaccccggtcacaatccgttggaacaatattaat |
48943001 |
T |
 |
| Q |
201 |
tgttcactttctgataaat |
219 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
48943002 |
tgttcactttctgataaat |
48943020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University