View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13867_low_9 (Length: 400)
Name: NF13867_low_9
Description: NF13867
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13867_low_9 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 178; Significance: 7e-96; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 178; E-Value: 7e-96
Query Start/End: Original strand, 46 - 223
Target Start/End: Complemental strand, 29479055 - 29478878
Alignment:
| Q |
46 |
tggctatatattctttttgactcacatgtgcttctgactgcaaatgtttgcaaacagttctccaataaagagcagcctctgcttccatcaatataatgct |
145 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29479055 |
tggctatatattctttttgactcacatgtgcttctgactgcaaatgtttgcaaacagttctccaataaagagcagcctctgcttccatcaatataatgct |
29478956 |
T |
|
| Q |
146 |
tggtggacaatgaaccccttcccctacaattaatatgcaaagcagtaaattatggtaagcaacagccaatcaggttaa |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29478955 |
tggtggacaatgaaccccttcccctacaattaatatgcaaagcagtaaattatggtaagcaacagccaatcaggttaa |
29478878 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 128; E-Value: 5e-66
Query Start/End: Original strand, 250 - 389
Target Start/End: Complemental strand, 29478845 - 29478706
Alignment:
| Q |
250 |
aataacaggtaagttgtcatcctggcattcaggaaactacatccaacgaggcacagcctcaatcactacacctgattgaccagttccataaatcttctca |
349 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
29478845 |
aataacaggtaagttgtcatcctggcattcaggaaactacatccaacgaggcacagcctcaatcactccacctgattgaccagttccataaatcttctca |
29478746 |
T |
|
| Q |
350 |
cgcaatttgagctcctgctcgtaaaattgcttgatcagct |
389 |
Q |
| |
|
|||||||||||||| |||||||||||||| |||||||||| |
|
|
| T |
29478745 |
cgcaatttgagctcgtgctcgtaaaattgtttgatcagct |
29478706 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University