View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13868_low_5 (Length: 311)
Name: NF13868_low_5
Description: NF13868
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13868_low_5 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 27 - 295
Target Start/End: Complemental strand, 52519593 - 52519330
Alignment:
| Q |
27 |
aatttattttggtaggcataggtctctgaacagtgtcttgggttagggagagactagaaaagaaaagaaaaggactttgtggttgcgtctttattaccat |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
52519593 |
aatttattttggtaggcataggtctctgaacagtgtcttgggttagggagagaccagaaaaga-----aaaggactttgtggttgcgtctttattaccat |
52519499 |
T |
|
| Q |
127 |
agcgtaaaagggtctctttctctttctctcactttgttttagctgctattactgtttttgtttcaaaacctctgagctttgatgggttcatgctgttaca |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52519498 |
agcgtaaaagggtctctttctctttctctcactttgttttagctgctattactgtttttgtttcaaaacctctgagctttgatgggttcatgctgttaca |
52519399 |
T |
|
| Q |
227 |
tcctcggtaatctggaggaattcatggctctgtcataccttttctgtaccttttcttgggccatgtatc |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
52519398 |
tcctcggtaatctggaggaattcatggctctgtcacaccttttctgtaccttttcttgggccatgtatc |
52519330 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University