View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13869_high_37 (Length: 257)
Name: NF13869_high_37
Description: NF13869
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13869_high_37 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 21 - 247
Target Start/End: Complemental strand, 6026638 - 6026412
Alignment:
| Q |
21 |
ttcctagggcacatccgttggtatgtatacctacggctaagctccatcttttttagccactttgattaatgtcagacatattctctccaacggtccacca |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
6026638 |
ttcctagggcacatccgttggtatgtatacctacggctaggctccatcttttttagcaactttgattaatgtcagacatattctctgcaacggtccacca |
6026539 |
T |
|
| Q |
121 |
catccaataaaatatcgacggttgaatcatgattgtatctcgatttaatcgttgagatacgatggattaaccctagtacgtataggatgtgagtttgatt |
220 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6026538 |
catccaataaaatttcgaaggttgaatcatgattgtatctcgatttaaccgttgagatacgatggattaaccctagtacgtataggatgtgagtttgatt |
6026439 |
T |
|
| Q |
221 |
tatgtttggtttgtgcattcagttcat |
247 |
Q |
| |
|
|||||||| |||||||||||||||||| |
|
|
| T |
6026438 |
tatgtttgttttgtgcattcagttcat |
6026412 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University