View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13869_high_37 (Length: 257)

Name: NF13869_high_37
Description: NF13869
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13869_high_37
NF13869_high_37
[»] chr3 (1 HSPs)
chr3 (21-247)||(6026412-6026638)


Alignment Details
Target: chr3 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 21 - 247
Target Start/End: Complemental strand, 6026638 - 6026412
Alignment:
21 ttcctagggcacatccgttggtatgtatacctacggctaagctccatcttttttagccactttgattaatgtcagacatattctctccaacggtccacca 120  Q
    ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||    
6026638 ttcctagggcacatccgttggtatgtatacctacggctaggctccatcttttttagcaactttgattaatgtcagacatattctctgcaacggtccacca 6026539  T
121 catccaataaaatatcgacggttgaatcatgattgtatctcgatttaatcgttgagatacgatggattaaccctagtacgtataggatgtgagtttgatt 220  Q
    ||||||||||||| |||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
6026538 catccaataaaatttcgaaggttgaatcatgattgtatctcgatttaaccgttgagatacgatggattaaccctagtacgtataggatgtgagtttgatt 6026439  T
221 tatgtttggtttgtgcattcagttcat 247  Q
    |||||||| ||||||||||||||||||    
6026438 tatgtttgttttgtgcattcagttcat 6026412  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University