View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13869_high_41 (Length: 237)
Name: NF13869_high_41
Description: NF13869
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13869_high_41 |
 |  |
|
| [»] chr8 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 78; Significance: 2e-36; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 124 - 237
Target Start/End: Original strand, 44277377 - 44277489
Alignment:
| Q |
124 |
taacattttagttagtaactaagtatatcggnnnnnnnnnatcaaccctaagaagaatgatcaactgaacccgcatattagactctacaaacataattta |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44277377 |
taacattttagttagtaactaagtatatcggtttttttt-atcaaccctaagaagaatgatcaactgaacccgcatattagactctacaaacataattta |
44277475 |
T |
 |
| Q |
224 |
tgtgatatttgatt |
237 |
Q |
| |
|
| |||||||||||| |
|
|
| T |
44277476 |
tatgatatttgatt |
44277489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 23 - 56
Target Start/End: Original strand, 44277276 - 44277309
Alignment:
| Q |
23 |
tagcctaccctacattgtattggtcaagatgaat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
44277276 |
tagcctaccctacattgtattggtcaagatgaat |
44277309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 202 - 234
Target Start/End: Complemental strand, 44277680 - 44277648
Alignment:
| Q |
202 |
tagactctacaaacataatttatgtgatatttg |
234 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
44277680 |
tagactctacaaacataatttatgtgatatttg |
44277648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University