View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13869_low_34 (Length: 281)
Name: NF13869_low_34
Description: NF13869
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13869_low_34 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 210; Significance: 1e-115; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 27 - 261
Target Start/End: Original strand, 40546276 - 40546510
Alignment:
| Q |
27 |
catatactaatctgtcttggtaggttgaagatggtttttatgcaacnnnnnnngcaccggctcaaactgttattcttcacaataacttggttggcagtaa |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
40546276 |
catatactaatctgtcttggtaggttgaagatggtttttatgcaaccttttttgcaccggctcaaactgttattctgcacaataacttggttggcagtaa |
40546375 |
T |
 |
| Q |
127 |
cttatatttgtcttaaaagcaatttttgtgactttgttggttgtaacttatctgcttccttactagcagatgcatattcttatccaaccctattcaagcc |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40546376 |
cttatatttgtcttaaaagcaatttttgtgactttgttggttgtaacttatctgcttccttactagcagatgcatattcttatccaaccctattcaagcc |
40546475 |
T |
 |
| Q |
227 |
tattttaacccgttgtcgctattttatctcccttt |
261 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
40546476 |
tattttaacccgttgtcgctattttatctcccttt |
40546510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 24 - 70
Target Start/End: Original strand, 31790848 - 31790894
Alignment:
| Q |
24 |
atccatatactaatctgtcttggtaggttgaagatggtttttatgca |
70 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
31790848 |
atccatatactaatctgtcttggtaggttgaaggcagtttttatgca |
31790894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University