View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13869_low_35 (Length: 275)
Name: NF13869_low_35
Description: NF13869
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13869_low_35 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 20 - 267
Target Start/End: Complemental strand, 36126853 - 36126606
Alignment:
| Q |
20 |
tgctgtgatttgtaggtgtaaacctgatgctgagacatacaatgctcttattaatgcgcatggtcgagccggacaatggcgttgggctataaatattatg |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
36126853 |
tgctgtgatttgtaggtgtaaacctgatgctgagacatacaatgctcttattaatgcgcatggtcgagccggacaatggcgttgggctatgaatattatg |
36126754 |
T |
 |
| Q |
120 |
gatgacatgctgcgtgcagctgtgtgtactttgtattttcttcccttatcaatcttcagtgacaccaaatttatgtgatcatcatttctttcttggtcgt |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
36126753 |
gatgacatgctgcgtgcagctgtgtgtactttgtattttcttcccttatcaatcttcagtgactccaaatttatgtgatcatcatttctttcttggtcgt |
36126654 |
T |
 |
| Q |
220 |
aattctagattgtagttgagcttgaaaacacaatatcatgcctatgct |
267 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
36126653 |
aattctagattgtagttgagcttgaaaacacaatatcatgcctgtgct |
36126606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University