View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13869_low_36 (Length: 271)
Name: NF13869_low_36
Description: NF13869
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13869_low_36 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 16 - 255
Target Start/End: Complemental strand, 4603991 - 4603754
Alignment:
| Q |
16 |
ataaaggataagacatgacaaccttcataagattataatctctcgctaaaccacaacataaggtcttatctcaagtatatgttgtataaatacttaaata |
115 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||| || | ||||||||||||||||||||||||||||| ||||| |
|
|
| T |
4603991 |
ataaaggataagacatgacaac-ttcataagattatcatctctcgctaaaccacaacacaactttttatctcaagtatatgttgtataaatactcaaata |
4603893 |
T |
 |
| Q |
116 |
ctattttgcccatcaaacatcaaataagatnnnnnnnnttaaataccataaaaacttgtcttatattgtgatgtttagtccaatatttacatctaaatag |
215 |
Q |
| |
|
| ||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
4603892 |
cccttttgcccatcaaacatcaaataagat-aaaaaatttaaataccataaaaacttatcttatattgtgatgttctgtccaatatttacatctaaatag |
4603794 |
T |
 |
| Q |
216 |
atcaaactataatttgcttgagataagcctctataattgt |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
4603793 |
atcaaactataatttgcttgagataagcctatataattgt |
4603754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University