View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13869_low_48 (Length: 212)
Name: NF13869_low_48
Description: NF13869
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13869_low_48 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 13 - 195
Target Start/End: Complemental strand, 5208163 - 5207981
Alignment:
| Q |
13 |
aatatctgaggttataactttaggctacaaccatcaaccaatttgatcaatatggccatctgaagaagccgcaaaggttgttgttcacattgaatatttg |
112 |
Q |
| |
|
||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5208163 |
aatatctgaagttataactttaggctccaaccatcaaccaatttgatcaatatggccatctgaagaagccgcaaaggttgttgttcacattgaatatttg |
5208064 |
T |
 |
| Q |
113 |
agtcagatgagagtaatagcttgcattaaatacagttatggttgccccttaacaagtcaaatactcacggtcacggtttactt |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
5208063 |
agtcagatgagagtaatagcttgcattaaatacagttatggttgccccttaacaagtcaaatactcacggtcacggtgtactt |
5207981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University