View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1386_high_25 (Length: 318)

Name: NF1386_high_25
Description: NF1386
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1386_high_25
NF1386_high_25
[»] chr2 (1 HSPs)
chr2 (37-241)||(26210355-26210559)


Alignment Details
Target: chr2 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 37 - 241
Target Start/End: Complemental strand, 26210559 - 26210355
Alignment:
37 aaatcgttcaattatcgttattgaagatattgattgttccgtggatttaaccgcagatagaatgtcgaagaaaaatggtgcaaagtcgttgtctaagtct 136  Q
    ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26210559 aaatcgttcaattatcgttattgaagatattgattgttctgtggatttaaccgcagatagaatgtcgaagaaaaatggtgcaaagtcgttgtctaagtct 26210460  T
137 aagaaacataaaacaacatcgttttctggttcaggttgtgatgagagtagtcgggtcacactttcggggctccttaattttacggatgggctatggtcat 236  Q
    ||||||||||||||||||||||||||||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26210459 aagaaacataaaacaacatcgttttctggttcgagttgtgatgagagtagtcgggtcacactttcggggctccttaattttacggatgggctatggtcat 26210360  T
237 tttgt 241  Q
     ||||    
26210359 gttgt 26210355  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University