View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1386_high_26 (Length: 313)
Name: NF1386_high_26
Description: NF1386
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1386_high_26 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 124; Significance: 9e-64; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 124; E-Value: 9e-64
Query Start/End: Original strand, 149 - 307
Target Start/End: Original strand, 42358239 - 42358406
Alignment:
| Q |
149 |
atttcacggtggattcacaaaataaacccaaaccagaaccactattgctt---------ttaatttcacaagatgcttgaaacgattaaatacctaatcg |
239 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42358239 |
atttcacggtggattcaccaaataaacccaaaccagaaccactattgcttgcttcagatttaatttcacaagatgcttgaaacgattaaatacctaatcg |
42358338 |
T |
 |
| Q |
240 |
gatcggcgggtcaaagcggttttggatccaaatccaccgccgaaccagtcacggaaacctgcggcgat |
307 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
42358339 |
gatcggcgggtccaagcggttttggatccaaatccaccgccgaacaagtcacggaaacctgcggcgat |
42358406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 42 - 90
Target Start/End: Original strand, 42358186 - 42358234
Alignment:
| Q |
42 |
atctaagcatagcatactgacagtgtatgtaaaagataaccaaccacct |
90 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42358186 |
atctaagcatagcatactgacagtgtatgtaaaagataaccaaccacct |
42358234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University