View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1386_low_21 (Length: 396)
Name: NF1386_low_21
Description: NF1386
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1386_low_21 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 30 - 363
Target Start/End: Original strand, 49082465 - 49082812
Alignment:
| Q |
30 |
gatctaccatcaatctctggtttttcattacttacccaaatcatggaccatcactattgcaaaaacattcctctcataagtatg---------------- |
113 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
49082465 |
gatctcccatcaatctctggtttttcattacttacccaaatcatggaccatcacaattgcaaaaacattcctctcataagtatgttatgttatgttatgt |
49082564 |
T |
 |
| Q |
114 |
----ttatgtctgaactaattaaataacttccttcttcatgtttcctcattacatcatgtatgtaaatgtaatttgcagtgatgtcttctcaagattcag |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49082565 |
tatgttatgtctgaactaattaaataacttccttcttcatgtttcctcattacatcatgtatgtaaatgtaatttgcagtgatgtcttctcaagattcag |
49082664 |
T |
 |
| Q |
210 |
ttagcactgtattcaaattcatgctcaacggggctgtcgattttctcattaaaccagttcgcaggaatgagcttaggaacctgtggcagcatgtgtggag |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
49082665 |
ttagcactgtattcaaattcatgctcaacggggctgtcgattttctcattaaaccagttcgcaggaatgagcttaggaacttgtggcagcatgtgtggag |
49082764 |
T |
 |
| Q |
310 |
aagaaatactactgtatgtcaatgtcaatatacttacttatattccaatccaac |
363 |
Q |
| |
|
||||||||||||||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
49082765 |
aagaaatactactgt------atgtcaatatacttatttatattccaatccaac |
49082812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University