View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1386_low_27 (Length: 322)
Name: NF1386_low_27
Description: NF1386
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1386_low_27 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 256; Significance: 1e-142; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 30 - 314
Target Start/End: Original strand, 9145999 - 9146287
Alignment:
| Q |
30 |
cactgttgatgaactctacgaacacctcaacgcacccaagtttgttgacttctcgtctctcaatcacaacaccaacaacaatgatgatgaagcttggttt |
129 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9145999 |
cactgttgatgaactctacgaacacctcaacgcacccaagtttgttgacttcttgtccctcaatcacaacaccaacaacaatgatgatgaagcttggttt |
9146098 |
T |
|
| Q |
130 |
tgcaaacctggttagttttctctctttctttcaagttattcctcaattgggtctctcaaatttcgcatctttcttaattgggtcttgttcatttattgat |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9146099 |
tgcaaacctggttagttttctctctttctttcaagttattcctcaattgggtctctcaaatttcgcatctttcttaattgggtcttgttcatttattgat |
9146198 |
T |
|
| Q |
230 |
tttgtagttgtagattgcatttttcgcaattgggtttgttaaagttttgatttttatt----ggtcttattcatttcttgatattgttg |
314 |
Q |
| |
|
||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
9146199 |
tttgtagctgtagattgcatttttcacaattgggtttgttaaagttttgatttttattaatgggtcttattcatttcttgatattgttg |
9146287 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 236 - 307
Target Start/End: Original strand, 9146364 - 9146439
Alignment:
| Q |
236 |
gttgtagattgcatttttcgcaattgggtttgttaaagttttgatttttatt----ggtcttattcatttcttgat |
307 |
Q |
| |
|
||||| ||||||||||||| ||||||||||| ||||||||| |||||||||| |||||||||||||||||||| |
|
|
| T |
9146364 |
gttgttgattgcatttttctcaattgggtttcttaaagtttggatttttattaatgggtcttattcatttcttgat |
9146439 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 221 - 276
Target Start/End: Original strand, 9146440 - 9146495
Alignment:
| Q |
221 |
tttattgattttgtagttgtagattgcatttttcgcaattgggtttgttaaagttt |
276 |
Q |
| |
|
||||||| | |||| ||||||||||||||||||| ||||||||||| |||||||| |
|
|
| T |
9146440 |
tttattgttgttgttgttgtagattgcatttttcttaattgggtttgctaaagttt |
9146495 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 237 - 286
Target Start/End: Original strand, 9146282 - 9146331
Alignment:
| Q |
237 |
ttgtagattgcatttttcgcaattgggtttgttaaagttttgatttttat |
286 |
Q |
| |
|
|||| ||||||||||||| ||||||||||| | ||||||| ||||||||| |
|
|
| T |
9146282 |
ttgttgattgcatttttctcaattgggtttctcaaagtttggatttttat |
9146331 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University