View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1386_low_29 (Length: 318)
Name: NF1386_low_29
Description: NF1386
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1386_low_29 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 37 - 241
Target Start/End: Complemental strand, 26210559 - 26210355
Alignment:
| Q |
37 |
aaatcgttcaattatcgttattgaagatattgattgttccgtggatttaaccgcagatagaatgtcgaagaaaaatggtgcaaagtcgttgtctaagtct |
136 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26210559 |
aaatcgttcaattatcgttattgaagatattgattgttctgtggatttaaccgcagatagaatgtcgaagaaaaatggtgcaaagtcgttgtctaagtct |
26210460 |
T |
 |
| Q |
137 |
aagaaacataaaacaacatcgttttctggttcaggttgtgatgagagtagtcgggtcacactttcggggctccttaattttacggatgggctatggtcat |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26210459 |
aagaaacataaaacaacatcgttttctggttcgagttgtgatgagagtagtcgggtcacactttcggggctccttaattttacggatgggctatggtcat |
26210360 |
T |
 |
| Q |
237 |
tttgt |
241 |
Q |
| |
|
|||| |
|
|
| T |
26210359 |
gttgt |
26210355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University