View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1386_low_30 (Length: 318)
Name: NF1386_low_30
Description: NF1386
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1386_low_30 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 159; Significance: 1e-84; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 159; E-Value: 1e-84
Query Start/End: Original strand, 97 - 279
Target Start/End: Complemental strand, 20698817 - 20698635
Alignment:
| Q |
97 |
aagtttaggttcaagataagaaagaaaatggacactttcctcacttatttggatatgctatggtcaaattccaaatttgaaagaaattataataatttca |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20698817 |
aagtttaggttcaagataagaaagaaaatggacactttcctcacttatttggatatgctatggtcaaattccaaatttgaaagaaattataataatttgg |
20698718 |
T |
 |
| Q |
197 |
tacaacataacaaaaaacatcccccataaattaggaggaggaggagggtttagatgatacgtaaactaagcttgtactctgtg |
279 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||| |||||||| |||||||||||||||||||||| |||| |
|
|
| T |
20698717 |
tacaacataacaaaaaacatcccccataaattgggaggaggaggagagtttagataatacgtaaactaagcttgtactttgtg |
20698635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University