View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1386_low_31 (Length: 313)

Name: NF1386_low_31
Description: NF1386
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1386_low_31
NF1386_low_31
[»] chr8 (2 HSPs)
chr8 (149-307)||(42358239-42358406)
chr8 (42-90)||(42358186-42358234)


Alignment Details
Target: chr8 (Bit Score: 124; Significance: 9e-64; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 124; E-Value: 9e-64
Query Start/End: Original strand, 149 - 307
Target Start/End: Original strand, 42358239 - 42358406
Alignment:
149 atttcacggtggattcacaaaataaacccaaaccagaaccactattgctt---------ttaatttcacaagatgcttgaaacgattaaatacctaatcg 239  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||         |||||||||||||||||||||||||||||||||||||||||    
42358239 atttcacggtggattcaccaaataaacccaaaccagaaccactattgcttgcttcagatttaatttcacaagatgcttgaaacgattaaatacctaatcg 42358338  T
240 gatcggcgggtcaaagcggttttggatccaaatccaccgccgaaccagtcacggaaacctgcggcgat 307  Q
    |||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||    
42358339 gatcggcgggtccaagcggttttggatccaaatccaccgccgaacaagtcacggaaacctgcggcgat 42358406  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 42 - 90
Target Start/End: Original strand, 42358186 - 42358234
Alignment:
42 atctaagcatagcatactgacagtgtatgtaaaagataaccaaccacct 90  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||    
42358186 atctaagcatagcatactgacagtgtatgtaaaagataaccaaccacct 42358234  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University